Soop

NAME
SYNOPSIS
DESCRIPTION
OPTIONS
OUTPUT FILE FORMATS
USAGE
FILES
VERSION
BUGS
AUTHOR
SEE ALSO
COPYRIGHT

NAME

soop - system for optimized overgo picking

SYNOPSIS

soop [options] <PipMaker/BLAST filename>

soop [options] -p <primer filename> <FASTA filename>

DESCRIPTION

Soop designs ``overgo'' DNA hybridization probes either from a sequence comparison or a straight FASTA file. The basic idea behind designing probes from sequence comparisons is that orthologous sequences between two species that are highly concerved are likely to also be conserved in a third species. Soop runs in these two modes depending on the type of file passed to it as the last parameter on the command line.

FASTA: If a FASTA formatted file is passed to soop then the sequences are converted to overgos optimizing for GC content. The only relevant options are: -f -p -i -n -l -o -t -w
NCBI BLAST or PipMaker Verbose: If a sequence comparison output is sent to soop it will try to design and pick overgos based on spacing between probes and sequence homology for use in comparitive species probe design. All options are relevant.

OPTIONS

filename: Either PipMaker verbose or standard BLAST 2.0 (requires NHGRI::blastall.pm) to pick overgos from species comparison data or FASTA to just make overgos. This must be the last argument when calling soop
-a filename: ``All overgos'' File containing the overgo from every pip that meets the GC content requirements optimizing first for sequence similarity and second for GC content. This file is not written by default.
-f filename: File containing the selected overgos only maximizing percent identity and spacing then GC content in BLAST or PipMaker modes. In FASTA mode simply contains all the overgos that could be made maximizing for GC content. Defaults to ``overgos''
-g number: The ideal spacing between probes in kilobases. Soop trys to make the probes from ungapped alignments this far apart. Defaults to 30.
-h: Print out this message (requires perldoc in your path) and exit. (Overrides all other options)
-i decimal: Proportion minimum identity for probes to be made. In other words if i is .80 no overgo will be made with less than 80% similarity between the two sequences. Defaults to .80.
-l length: Length in bases of overgo to design. If l is 36 then the overgos will be made of two primers who's final lengths post extension will be 36 base pairs. Defaults to 36.
-n text: Prefix for names of primers in .stj (primers) file. If this option is present the primers will be named <prefix>##.1 and <prefix>##.2 for each primer with the ## incrementing by one from 00. If a primer file is written and this option is not specified the primer names will be the first ``words'' on the defline that match the character class [A-Za-z0-9_-.].
-o length: Overlap in bases between the two primers. Defaults to 8
-p filename: Name of file to write primers in (In ``Send to Jackie'' format). When making overgos from a FASTA formatted file this is the primary output filename. Not written by default.
-Q: Use the Query sequence for probe spacing. Otherwise uses the reference sequence to determine probe spacing. If you're blasting your reference sequence against a library of other sequences then use this option.
-r: Make probes/overgos from the ``reference'' or ``subject'' sequence. This does not affect which coordinates are used for setting probe spacing. By default the probes are made from the Query sequence.
-s offset: Start at this offset (in bases). This option isn't used very much, it describes an offset to start making probes at. In other words if you wanted to make some probes but skip the first 100kb of reference sequence you would set this to 100000. Deafults to 0.
-S filename: Write summery information about the probes chosen to this file. Not written by default.
-t decimal: Target proportion GC for the overgo as a whole. Defaults to .5
-v: Print the version number and exit. (Overrides all other options except -h)
-w decimal: Wiggle room for the GC proportion. In other words the amount the GC content can vary from the ideal GC content; if -t was set to .5 and -w was set to .06 than the GC content of the overgo would have to be in the range of 44% to 56% GC. Defaults to .06

OUTPUT FILE FORMATS

overgo file: The overgo files (those written by the -f and -a options) are written in FASTA Format. With the defline in the following format:

 ><defline> ### pip:[ref:(<start>-<end>) query:(<start>-<end>) \
    id:<percent_identity>] og:[id:<id>% offset:<start> diff:<diff>]

<defline>

The defline of the query sequence if in a comparison mode (BLAST or PipMaker). The defline of the fasta entry if in FASTA mode.

pip:[ref:(<start>-<end>) query:(<start>-<end>) id:<%id>%]

The characteristics of the pip that this overgo was made from. Start and ending coordinates in the reference/subject sequence and start and end coordinates in the query sequence. If in FASTA mode the reference coordinates (ref:(#-#)) will be 0 to the length of the fasta entry. Either ``ref'' or ``query'' will be capitalized to indicate which sequence the overgo was made from.

og:[id:<%id> offset:<start>

The characteristics of the overgo itself. <%id> is the percent identity of the overgo alone. <start> is the number of bases from the first base of the ungapped alignment or contig that the overgo starts.

diff:<diff>

This is a sequence comparison between the sequence of the overgo and the other sequence. From this you can retrieve either the overgo sequence or the sequence it was compared to. The format is the overgo sequence with a > after any base that changes where _ indicates a gap on either side. For example the following aligned sequences:


    ACTG TCAGA
    || |-:|-||
    ACGGTCC GA

would be represented ``ACT>GG_>TCA>_GA'' The format can be converted to the sequence of the overgo with the regular expression s/\>[ACTG]|_//g or to the sequence it was compared to with the regular expression s/[ACTG]\>|_//g.

primer file

Format of the primer file is simply the name of the primer <tab> then the sequence of that primer. Primer names are the overgo name with a .1 or .2 appended depending whcih strand the oligo is from. For example

    4href03.1   GCTGGGTGTGCCTGGGGATCAT
    4href03.2   GTTTTAACAATAAAATGATCCC

USAGE

This is a brief summary of how we use soop.

soop

soop text_file

must

soop

-a

FILES

Uses Bio::SearchIO to parse blast reports. Available at http://www.bioperl.org

VERSION

soop $Revision: 2.15 $ $Date: 2004/01/28 19:26:25 $ UTC

BUGS

Files with long stretches of NNNNNN's that span more than one line cause the PipMaker text file parser (parseVerbose) to barf and give incorrect data (subject becomes query).

Will overwrite input file in FASTA mode without asking permission. This is especially insidious when the input filename is ``overgos''. (note to self: should be fixed in getParams())

Should have offset (-s) or ``start at'' option for FASTA mode.

AUTHOR

Written by Arjun Prasad (aprasad@nhgri.nih.gov)

Some ideas taken from overgomaker by John D. McPherson (overgo GC content optimization)

COPYRIGHT

PUBLIC DOMAIN NOTICE

This software/database is ``United States Government Work'' under the terms of the United States Copyright Act. It was written as part of the authors' official duties for the United States Government and thus cannot be copyrighted. This software/database is freely available to the public for use without a copyright notice. Restrictions cannot be placed on its present or future use.

Although all reasonable efforts have been taken to ensure the accuracy and reliability of the software and data, the National Human Genome Research Institute (NHGRI) and the U.S. Government does not and cannot warrant the performance or results that may be obtained by using this software or data. NHGRI and the U.S. Government disclaims all warranties as to performance, merchantability or fitness for any particular purpose.

In any work or product derived from this material, proper attribution of the authors as the source of the software or data should be made, using: Thomas et.al., 2002 ``Parallel Construction of Orthologous Sequence-Ready Clone Contig Maps in Multiple Species'' Genome Res. 12:1277-85 as the citation.

Comments, suggestions and problems to bioinformatics@nhgri.nih.gov

Privacy Contact Accessibility Site Index Staff Directory Home